SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30139.Seq
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
chromo20
Bm_scaf37
4206046 bp
UniRef
UniRef50_UPI0000DB7BB2 (57%/111)
Cluster: PREDICTED: similar to CG8494-PA; n=1; Apis mellifera|Rep: PREDICTED: similar to CG8494-PA - Apis mellifera
Ontology
GO:0004221 F obsolete ubiquitin thiolesterase activity
GO:0006511 P ubiquitin-dependent protein catabolic process
GO:0006512 P obsolete ubiquitin cycle
GO:0008270 F zinc ion binding
Orthologue
Sequence
(Nucleotide)
CTCGTGCCGAATTCGGCACGAGCAAAAAGCGGTTCATCAGGCGACGGCAGCAACGTGAAG
TACCGAAGCATCATATCCGACGTGTTCGANGGGAAGTTACTATCAGCCGTTCAGTGCCTA
ATATGTGACAGGGTATCAACGAGAATAGAAACATTCCAAGACTTGTCGCTGCCGATCCCG
TCCCGGGAACACTTGGCCGTGCTGCGCTGCCAGCAGCCCATGCTGAACCACCACGCGGCC
CACAACGCACAGGATCCTGGGTGTGGTGGTTGCTCAGCTGGCTGCGGTCCTGGTTCTACG
GGCCGGTGGTGTCGTTGCAAGACTGTCTGGCCGCCTTCTTCAGCGCCGACGAACTCAAAG
GCGACAACATGTACAGCTGCTCCCGCTGCAAGAAATTACGTAACGGCGTGAAGCTATCCG
GCATCGTGGTGCTGCCCGANGTGCTGTGCGTCCACTTGAAGCGCTTCCGGCACGAGCTGC
TGTTCAGCGCCAAGGTGGCCGCCAGNNTGCCTTCCCCATCAACGATCTGGACATGACGCC
TTACACGCACAAAGAGTGCACCTCGTNCCGTNTCGCGGTACTCGCTGGNNGCGGTGATCA
GCCACATGGGCACGGTAGGCGGCGGGGCACTACAACGTTNCNCGGTNCCGCCGNNCCCCN
GCTTGGTTACTCCTTCCAACGAACCAAGGCCGTGCGG
(697 bp)

- SilkBase 1999-2022 -