SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30137.Seq
JBrowseBomo_Chr16
chromosome_No.
Scaffold_id
Scaffold Length
chromo16
Bm_scaf124
657554 bp
UniRef
UniRef50_Q4TEL0 (61%/109)
Cluster: Chromosome undetermined SCAF5294, whole genome shotgun sequence; n=2; Tetraodon nigroviridis|Rep: Chromosome undetermined SCAF5294, whole genome shotgun sequence - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0000166 F nucleotide binding
GO:0003676 F nucleic acid binding
GO:0004812 F aminoacyl-tRNA ligase activity
GO:0004815 F aspartate-tRNA ligase activity
GO:0005524 F ATP binding
Orthologue
Sequence
(Nucleotide)
GTTTGTCGGTGAATTTAATTTTTCCAATACTTTATTTCAAAAGGAAGTAATTAAGTGAGA
ATTTACAAAGAGTAATAGTTAGTGAGTAATCTTTCAACATGCCGGACGTTGGAAACCTTA
GCTTGTCCGAGATATATACCTCGGATAAGAATGGCAATGACGATACAGGTGATGGTACGA
AAGAGAAACCATTCAAGACAATATTGAAAGCAATGCATCATGCTGGCAAAGAGCCATTTC
CCACAATTTATGTTACTCAAAAGATGACACTAAGGATTATGATGTAGCAGCAAAATCTCA
ATTGAAGAAAATCCAAAAGATTTGGGTCCGCGAGAACTATAAGGCGATGGACAAAGCTAA
GGCAGAAGAGGAGAACACTGAAAAGAGATCTCAAAACTTAGATGAGGCAAAGAAGATTCT
TCTGCAAGAGGATCCAAGTTTACCAAAGGCCACTGTTGTGAAAATATGTGAAACAACTGA
ACACCGTGGTCAGAGGATATGCATCAGAGATGGGTACATCGTCTCCGGCGCCAAGGTAAA
TCTCTGGCATTCCTGACCCTGCGTGATGGCACTGGGTACCTACAGTGCGTTCTACATGGT
TTACTATGTCAGACCTACAATGCTCTAGTCCTATCTACGGAGTCATCTGTGGTCTTGTAT
GGAAAATTAGAGGCTGTGCCCGAGGGAAAGAAGGCTCCGGGTGGTCATGAGCTGACAGCT
GATTACTGGGGAATTGATTGGACTCGCACCACCAGGTGGTGCGACGCCATCCTCAATGAG
GAAGCCTTGCCTGACGTGCAATTAGACCATAGGCNCATAATGATCCGCNGTGAGAACCCC
GTCCAAAGTCCTACGGGCTTCGCGGCCGCTGTGAC
(875 bp)

- SilkBase 1999-2022 -