SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30135.Seq
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf33
4426693 bp
UniRef
UniRef50_Q96483 (97%/85)
Cluster: Actin-51; n=584; Eukaryota|Rep: Actin-51 - Solanum lycopersicum (Tomato) (Lycopersicon esculentum)
Ontology
GO:0000166 F nucleotide binding
GO:0005198 F structural molecule activity
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005737 C cytoplasm
Orthologue
Sequence
(Nucleotide)
GTACAGCAATAACGAAGCTGTGCAATAGCAAGTTAATTTATTTATTTATAATAGAACTAT
TTAATTAAAAACTAATTCAAGATGTGCGACGAAGAAGTTGCCGCGTTGGTAGTAGACAAT
GGCTCCGGTATGTGCAAGGCCGGTTTCGCAGGAGATGATGCTCCTCGCGCCGTGTTCCCC
TCGATCGTGGGAAGGCCCCGCCATCAGGGCGTGATGGTCGGTATGGGACAGAAGGACTCT
TATGTAGGAGATGAGCACAGAGCAAAAGAGGTATCCTGACCCTCAAATACCCCATCGAAC
ACGGAATCGTCACTAACTGGGATGACATGGAGAAGATTTGGCATCATACCTTCTACAATG
AGCTGCGTGTCGCCCCCGAGGAACACCCAGTCCTGCTCACTGAGGCTCCCCTCAACCCCA
AGGCCAACAGAGAGAAGATGACCCAGATCATGTTCGAAACATTCAACACGCCCGCCATGT
ACGTCGCCATCCAAGCCGTGCTCTCGCTTACGCGTCCGGTCGTACCACCGGTATCGTGCT
GGACTCCGGCGACGGTGTCTCCCACACCGTGCCCATCTACGAGGGATACGCACTCCCCCA
CGCCATCCTGCGTCTGGACTTTAGCCGGTCGCGACTCACAGACTACCTCATGAAGATTCT
CACCGAGCGCGGCTACTCGTTCATTACCAACGCCGANCGGGAAATTCGTTCGTGAACATT
CAAGGAGAAGCTGTGCTACGTCGGCTCTTGACTTTCGAAGCAGGNGATTGGCCANCGGTT
GCATTCCAAGNAGTTTCCTTTCGAAGAAAGTTCTTACGNAANTTTCCCGGAACGGTTCAA
GGTCATTCAACCATTC
(856 bp)

- SilkBase 1999-2022 -