SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30134.Seq
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf22
5301712 bp
UniRef
UniRef50_Q8NST2 (35%/64)
Cluster: Putative uncharacterized protein Cgl0585; n=2; Corynebacterium glutamicum|Rep: Putative uncharacterized protein Cgl0585 - Corynebacterium glutamicum (Brevibacterium flavum)
Ontology
GO:0003677 F DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0006350 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
Orthologue
Sequence
(Nucleotide)
TGAAAACGACAATTCGCGCGTTTTGGTAATTAGATAAACGAGCAACGTTCGTATTTCGTA
TTAAGACTATCTCGTACGCTGTGCGGTGGTGTCTGTATTTGGACTCAGTTGGAAATGTTA
AGCGGAAAGGTTTTTGCTTGTATAGTTTTAGTGACTGTATGGATAAAAGCCGACTGCGCC
AGTCTACCGTTCATTCCAACGAGATTGGGGAGCGTCAAAGAAGTCAGCGCACCGGATATG
AGAGCCCCGGGTGACTGGTCCGAGCGAGGGTCCGCGAGGGGGTGCCGCCGCCGCTGTGTG
CAGGGCGGTGCGTGGCCCCGCCGGCAGGACCAGTATGCGCCTTTGATGCAGCCGGAACGG
GANGGACATTCGCTACTCTATGTGAACTCGAGGCTGTTTCGTGNCGCGAAAGCAACGTAT
TACGCCGTCACAAGTTTGGGAGTTTGCTGAATAATTTAGAAATTAAGAAAATATGNTTAA
GTTTTAGTGCCATTTTTATGGAACTTATTTTGTAAGCCCATCTAATATTACGATAGATCA
TTTACATTAGTTAATTGGCAACGTACTCAATGGAAAAAATTTATTTGTGTTTTACGTAAT
TTTAGGGATAAATAATTTTAATCAGTATATATTTGCACACGTCGCGTCTTTCGTAATAAT
TTGGATGACAATACTCATTTGTTTACATAGTTCCNAAATTAGCAGGTCACCATTATTGGA
ATCCTCTTCCAATGGTTAAATTTACATACTTNAATGTTTGTTNGGNGAATTGTTTACAAT
AATGGNCCACTCCATGTGGCCATGCCCTGAATTAAAATTNGGNATACCCCANCGNTTTAA
AATCCAAACGCTTTCCCTTTAACCCAATGGGGGTAAAAACCC
(882 bp)

- SilkBase 1999-2022 -