SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30133.Seq
JBrowseBomo_Chr19
chromosome_No.
Scaffold_id
Scaffold Length
chromo19
Bm_scaf36
4352778 bp
UniRef
UniRef50_Q187Y3 (41%/39)
Cluster: Putative membrane protein; n=2; Clostridium difficile|Rep: Putative membrane protein - Clostridium difficile (strain 630)
Ontology
GO:0004222 F metalloendopeptidase activity
GO:0005515 F protein binding
GO:0006508 P proteolysis
GO:0008233 F peptidase activity
GO:0016020 C membrane
Orthologue
Sequence
(Nucleotide)
TTTTTTTTTTTTTTTTTTTTTTTTCGTCACACCTTATTATTCAAAAGTAACATCTTATAA
CATAATGAGTATAACAACTAAACTCAAATAAAAAAAAAGGTTGAAAACGTACATAGTAAA
TAACTCTAACTTAGTATTCAAATCACTCTTTAATGTTTTGTTGATCACTTCAACGAACTG
GTATTGAACTAAACATCTATGGCATGATGGTAGAAGTAATTCAAACTGCAAACTTATTTC
TACTTATAATAATCTCACAGATTATAGTTTTATACTACATTTCAGTTAGTCAATTTTGTA
CAGGGATAAACATAATTGATATATTTATGAGGTCTTCTCAAGAGATTCAAACGAAACAAA
ATAGAATTGAAACAAAAATATGAATAACTGAAAACTATAGATAATAGAGCAACTTTGTTA
AACTTTTAAGTGAGCAATTTTCACTTGAACATCACAGAATCGCATGTCATTCTATGCACT
ATAATGTTTCGTGTTAAATTCTTGGCACATATAATACGTAAAATATAAAANAAAAAAAAC
ACCACTTCTAATAGTGTAAAAATAATAAACGTAAGTACAGCGGAATAAAGTAATTCGAAA
TATCGGGGTTATTGCGCGTCAAAGTTGAGCAAGCTGCAGTTGCCTGAAGGCAATTTAATC
TTAGAAAAATATTCTTATTTCTAAAAAAAAAAA
(693 bp)

- SilkBase 1999-2022 -