SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30132.Seq
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf12
6701349 bp
UniRef
UniRef50_Q5AMQ3 (30%/53)
Cluster: Putative uncharacterized protein RGA2; n=1; Candida albicans|Rep: Putative uncharacterized protein RGA2 - Candida albicans (Yeast)
Ontology
GO:0005622 C intracellular anatomical structure
GO:0007165 P signal transduction
GO:0008270 F zinc ion binding
GO:0046872 F metal ion binding
GO:0005737 C cytoplasm
Orthologue
Sequence
(Nucleotide)
TTTTCGTTACTATTCAAATTTTATTTCAATACATACCTACCCAAAAAAGTCAAGTTTAAT
TATGGATAAAGGTCAAGAACAAGTCAAAAAGCCATTTTGTGCTCGATGTTTTTTACCTGT
GGATTCTGAAGACACCATTGAAATAGCAGGGCAAAGCTTTCATCGAATTTGCTGCACGTG
TTGCGTCTGCAGAACAATTCCGTCGGCGGTGAAGATGTTCTACGGGCACGTATTCTGCAA
TGGATGCTTCAAGCGCACGTGCTAGATCGGTTTAGAGGCGAATGTCCATCTGTCCACACA
AACTGGGCCCAGTGGACTTGTGGAAAGTTTGGAAATGGTCAGGAGGGGGATAATCCTGGA
GCAAGCAGCAAATCAGAGGCCTCTGAAGGGAATACTAAACGCAGCGTCTGCTCTCGATGC
CTTCAAATGATCAACGAGAATAACAAAATTGAAATTGACAAGCAGGCCTTCCATAGTCAC
TGTGCCAAGTGCTATTTTTGCCACACGGTCCATCGTCCAACATCCACATCTGCTATGGTC
AAGTCTTCTGCGAGCCTTGCTTCCAACATCACGTCTTGCACCGACATAAGGACAACCCCA
ATGAATTCTTCAAGCAATGCTTCGAGCAATTCGCGGACCCCAGATTTGCCGAGAATATGA
AGCAATTTATGGGCTGGGCAAGGATGGTG
(689 bp)

- SilkBase 1999-2022 -