SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30131.Seq
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf184
128674 bp
UniRef
UniRef50_P08865 (84%/84)
Cluster: 40S ribosomal protein SA; n=242; Eukaryota|Rep: 40S ribosomal protein SA - Homo sapiens (Human)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005055 F laminin receptor activity
GO:0005622 C intracellular anatomical structure
GO:0005634 C nucleus
GO:0005737 C cytoplasm
Orthologue
Sequence
(Nucleotide)
AAAAACTTGTTCTGGCTGCTCGTGCTGTCGTAGCCATCGAGAACCCCGCTGATGTGTTCG
TCATCTCATCACGGNCCTTCGGTCAGCGTGCTGTACTGAAGTTTGCCGCNCACACCGGTG
CTACGCCTATTGCGGGACGTTTCACACCAGGTGCTTTTACTAACCAGATCCAAGCTGCAT
TCCGTGAACCTCGTCTCTTGATTGTATTGGACCCTGCACAANACCATCAACCCATTACTG
AAGCTTCATATGTCANATTCCTGTGATTGCTTTNTGCAACACAGACTCCCCACTAANATT
TGTGGACATTGCTATCCCATGCAACACCAAGTCTTCCCACTCTATTGGTTTGATGTGGTG
GTTGTTGGCACGTGAANTGCTNAGGCTTCGTGGTGTGCTTCCCCGTGACCAGNGCTGGGA
TGTTGTGGTTGATTTGTTCTTCTACCGTGACCCTGAAGAAAGTGAAAAGGATGAACAACA
AG
(482 bp)

- SilkBase 1999-2022 -