SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30125.Seq
JBrowseBomo_Chr13
chromosome_No.
Scaffold_id
Scaffold Length
chromo13
Bm_scaf1
16203812 bp
UniRef
UniRef50_Q2F5N3 (77%/119)
Cluster: Progesterone membrane binding protein; n=1; Bombyx mori|Rep: Progesterone membrane binding protein - Bombyx mori (Silk moth)
Ontology
GO:0020037 F heme binding
GO:0046914 F transition metal ion binding
Orthologue
Sequence
(Nucleotide)
AATAAAAACAAAAACTTAATGTGCCGGCACAGACGTTTTTCTACCTAGAATAAAATGGAT
TCACCACCAGAGGTTGAAAATGTGCAAGCCAAACACAGTGGCTTTTTTGAGACCTTAAAA
ACACTGTTTTGTCAACCGTTTATTTATTTTGTTTTTGTGAGTACATTTGTGATACTGTAT
AAATTTTACTACAAGTATAAGACACATTGTTCAAAGGTTGCTCCCTTGAAAAAACTACCT
AAATTGCGAAAAGAATGACCGCAGTAGAACTACGGCAGTACGACGGGACACAGGAGGGTG
GCAGAGTGTTGATGGCTGTGAATGGGTGGATATTCGATGTGACTAGAGGGAATCGGTTCT
ACGGTCCCGGTGGGCCATATGCTGTTTTTGGAGGAAGAGATGCCACAAGAGGACTCGCCA
CGTTCTCTGTCACAGCACCTGAAAAGGACTATGATGACTTGAGTGATCTCAACTCTATGG
AAATGGAATCAGTGAGGGAATGGGAGGACAATTTAGAGAGAATTATGATCTGGTCGGTCG
ACTTCTGAGGCCTGGTGAAGAACCCAGGAACTACTCGGACGAAGAACCCGAAGAAGCAGA
CACGTCCGCTCTGCCCAACGACGACAAAGAAAACCAAATTGGAACTTTCATTGCAAAATG
ACGGTAGCTTTACCAAGTAAAA
(682 bp)

- SilkBase 1999-2022 -