SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30123.Seq
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf939_contig44948
6851 bp
UniRef
UniRef50_P52275 (52%/145)
Cluster: Tubulin beta-2 chain; n=115; Bilateria|Rep: Tubulin beta-2 chain - Caenorhabditis elegans
Ontology
GO:0000166 F nucleotide binding
GO:0000212 P meiotic spindle organization
GO:0002119 P nematode larval development
GO:0003924 F GTPase activity
GO:0005198 F structural molecule activity
Orthologue
Sequence
(Nucleotide)
AATTTGCTATTTAACAATTTTTTTTTTACTAGTTTTAAGCTAATGTTAAGCATTTTATAC
AACATCTTTTGCTAGCTTTTTAAAGTAAATTTACAAGTATCTGTGACGAGAAATCGATAA
ATTAACAAGATGAGGGAAATTATCAATCTCCAGGTCGGTTCTTGTGGAAACCAAATCGGC
GGAAAGTTCTGGGAGGTGATATCTGACGAGCACGGCATCGATCCAAGCGGATGCTACCAC
GGCGACTCCGACCTCAACTCGAAAGGATCAACGTGTACTACAACGAGGCATCGGCTGGGA
AATATGTTCCTCGCACGGTTCTTATCGACTTGAAGCCGGCCACGATGGACGCGGTGAGGT
CGGGACCCTTCGGATGCCTATTCAGACCGGACAATTTCGTCTACGGACAAAACTGTGCGG
CCAACAACTGGGCGAAGGGACACTACACTGAAGGAGTAGAGATTCTGGAGTCTGCTTTAG
ATGTCATTCGAAGGGAAGCTGAGGGCTGGATTGCCTGCAAGTTTTCAGATGTCACACTCG
CTAGGTGGCGGTACCGGTTCCGGATTAGGTACGCTACTTCGTGAACAGGATACGCGAAGA
GTATCCCGACAGAATTATACTGACCTTTTCAGTCTTTCCAAGTCCCCGAGTGTCGGATTT
GTGTGGTGGAGCCATATAACACAACGCTGGGCGG
(694 bp)

- SilkBase 1999-2022 -