SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30122.Seq
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
chromo20
Bm_scaf37
4206046 bp
UniRef
UniRef50_P32100 (60%/92)
Cluster: 60S ribosomal protein L7; n=39; Fungi/Metazoa group|Rep: 60S ribosomal protein L7 - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0006412 P translation
Orthologue
Sequence
(Nucleotide)
AAAAGAAGGCTGCGGCTACCGACAAGAAGGCTGCGGCCGAGAAGAAGCCCGTCAAAGGGA
AGGAAGACAGTAAGAAGCTGCCTGCTGTACCAGAGTCAGTGCTCAAGCATCGTAAGAGGA
GAGAGGCTCTTCGCACTAGGAGATTACAGGTTACGCTAAAGAGGCGTTCTTCTGCCATCA
AGAAGAAGAGGGAAATCTTCAAGAGGGCTGAACAGTACGTCAAGGAATACCGCATCAAGG
AACGTGATGAAATCGACTAGCCAGACAAGCACGCAATCGTGGCAACTACTACGTTCCCGG
GGAAGCCAAATTGGCATTTGTCATCCGAATCCGTGGTATCAACCAAGTTTCACCGAAGTC
CGTAAAGTTCTGCAACTGTTTAGACTGCGCCAAATAAACAATGGTGTGTTTGTACGTCTG
AATAAGGCTACTGTGAATATGCTACGTATCGCCGAGCCTTACATTGCTTGGGGATACCCC
AACTTAAAGAGTGTCCGTGAGTTAGTATCAAACGTGGATTCGCCAAGCTGAGTGGACAAC
GTATACCAATCACTTCCAACAGCATTGTTGAGAAGAGGCTTCCATAAACACAACATTATC
TGTGTTGAGGACCTCATTCCATGAGATCTTCACTGTTGGAGAAAAGTTCAAGTACGCGAG
TAATTTCCT
(669 bp)

- SilkBase 1999-2022 -