SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30120.Seq
JBrowseBomo_Chr10
chromosome_No.
Scaffold_id
Scaffold Length
chromo10
Bm_scaf70
1945803 bp
UniRef
UniRef50_Q54VT8 (37%/79)
Cluster: Putative uncharacterized protein; n=1; Dictyostelium discoideum AX4|Rep: Putative uncharacterized protein - Dictyostelium discoideum AX4
Ontology
GO:0004370 F glycerol kinase activity
GO:0005975 P carbohydrate metabolic process
GO:0006072 P glycerol-3-phosphate metabolic process
GO:0016301 F kinase activity
GO:0016740 F transferase activity
Orthologue
Sequence
(Nucleotide)
TTTTTTTTTTTTTTTATAATAATAAACGCTTTTATTTAATGATCACAACATTGTTATAAC
AGAGCTATAAATAAATTAATACTTTTTTAAAATATAAACTAGCTTTGGAGGTATATTTAT
TTTCTAATGACTAACAATAGTTGATTTAACAACAGCATACTACATAGATTTTAATTTGTC
TGCAATAATCACTAGTAGGGCGGTTCCGAGGAAAAAAAGTCCCGGCGGCAAAACTGCAGT
AGTTCTATCTGATTTTCTGCGTTGACATGTTCATTTTTAGTATCGGTCCATCCCATGCAT
TTATTCAAGGCTTCTTCCCAACGAACTCGCCGCATTTCTCGTTCTTCATTGGTAAGAGCC
GGCAGGAATGTATCGGCCGGTGGGCTGGGTATTGTCGTGGGCCACACACGCATTGCGCGA
CCTGCGACAATGGCCGCCCCCAGGGCTGTACTTTCCATCATGAGGGGACGAATGACTGGT
ATACCCAGTAAATCAGCCTGCATCTGCACAGAACTGAGTTCTGCGCCATCCCTCCGTCGG
CGAGGAGTTGCCTCAGGGGCGCGCAGTNTTGCAGCC
(576 bp)

- SilkBase 1999-2022 -