SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30117.Seq
JBrowseBomo_Chr1
chromosome_No.
Scaffold_id
Scaffold Length
chromo1
Bm_scaf8
8002931 bp
UniRef
UniRef50_A2A246 (98%/71)
Cluster: Y-box protein; n=2; Bombyx mori|Rep: Y-box protein - Bombyx mori (Silk moth)
Ontology
GO:0003676 F nucleic acid binding
GO:0003677 F DNA binding
GO:0006355 P regulation of transcription, DNA-templated
Orthologue
Sequence
(Nucleotide)
AAAGCGGTGAACATCGAGGAGAGGTCGTGGAGTATTTTACCATCTTTGCCACCATCGCCG
TTCGCCAATTACACCATGGCTGATACCGAAAAGGCGCCGCAGCCGCAGCCCCAACAACAA
CTAGAACAACAACCTCAAGCTCAACAAGCTANAACAGTTAAACAAAAGCAGGTCATCGCT
GAGAAAGTATCGGGCACTGTGAAATGGTTCAACGTCAAGAGTGGATATGGTTTCATCAAC
AGGAATGACACCAAGAAGATGTGTTTGTGCATCAGACTGCCATCGCCCGTAACAACCCAC
GTAAGGCTGTGCGCTCGGTCGGCGACGGAGAGGCGGTGGAGTTTGCCGTGGTTGCCGGGG
AGAAAGGCTTTGAAGCAGCTGGTGTTACTGGTCCCGGTGGTGAGCCAGTAAAAGGCTCAC
CTTATGCTGCAGACAAGCGCCGTGGCTACCACCGCCAATATTTCCCTCGTCAAGGTGGCG
GACGAGGCGGTGAAGGAGCTCCACGCAGGGAGGATTAGGACGTCGTGGACCCCCGCCCAA
CCAAGGGGGTNCACAAGGAGATGAGGGTCAAGAAGGAGGCATTGTACCATCTCAGCGCAT
TTTTTCCG
(608 bp)

- SilkBase 1999-2022 -