SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30115.Seq
JBrowseBomo_Chr19
chromosome_No.
Scaffold_id
Scaffold Length
chromo19
Bm_scaf36
4352778 bp
UniRef
UniRef50_P55072 (66%/86)
Cluster: Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)- ATPase p97 subunit); n=169; Eukaryota|Rep: Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)- ATPase p97 subunit) - Homo sapiens (Human)
Ontology
GO:0000166 F nucleotide binding
GO:0005488 F binding
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
TTATAAAAATTATAATAGTTCTTAGATTCTAACAATAAATTTTGAATAAAATGGCAGATA
ATAAAAGCCCTGATGATTTATCGACCGCGATCCTCCGTCGCAAGGACAGACCCAACCGTC
TCATTGTCGAAGAAGCAGTCAGCGATGACAACTCAGTCGTGGCACTTTCACAGGCCAAAA
TGGAGCAACTTCAACTCTTCCGTGGTGACACAGTCTTGCTCAAGGGCAAACGCCGCAAGG
AAACCGTTTGCATCTGCTCTCAGACGATAATTGCCCTGATGAGAAAATTCGGATGAACCG
TGTTGTGAGAAACAACCTTCGTGTGCGTCTTTCTGATGTGGTATCCATCGCTCCGTGTCC
TTCAGTGAAATATGGAAAACGAGTCCACATACTGCCAATTGATGATTCAGTTGAGGGTCT
TACTGGCAATCTATTCGAAGTATACTTGAAGCCGTACTTCATGGAGGCTTACCGTCCGAT
CCATCGTGACGACACCTTCATGGTCCGCGGGGCATGCGCGCCGTCGAGTTCAAAGTGGTC
GAAACAGATCCATCACCATTTTGCATCGTGGCTCCTGATACCGTAATACACTGTGACGGT
GAACCGATTAAACGTGAGGAAGAAGAGGAAGCACTAAATGCTGTCGGCTATGATGACATC
GGCGGTTGTCGCAAACAACTGGGCGCAAAT
(690 bp)

- SilkBase 1999-2022 -