SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30112.Seq
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf64
2197771 bp
UniRef
UniRef50_Q1HQ32 (98%/77)
Cluster: Carboxypeptidase inhibitor; n=1; Bombyx mori|Rep: Carboxypeptidase inhibitor - Bombyx mori (Silk moth)
Ontology
GO:0004180 F carboxypeptidase activity
GO:0005576 C extracellular region
GO:0006952 P defense response
Orthologue
Sequence
(Nucleotide)
AAAACTAAAGCGAACACGTCATCATGAAGTTTTTATTATTTTGTGCAATGTGCATTTTAG
TTTACGGAAACAGTGAAGATGATTTCTGTGAAATAGATTCCATTGAACAAGAGGATCCGT
GCCGCAGGGAAGGTGGTTTGTGTACTGTGGCTGAGGACTGTCCATCTGATATCAGAGCCA
GAACTGGACTCTGTCCTAAGCAGCAAAAAGACGGAATCGAATGCTGTTACGGAGTGTCCG
TANAAGAGACCAGAGTCGGAAGCACGGCGGAGAATGTTTCTCGAAAGGCTACTGCAGTCA
ATCTTTGATATATGAAGAAGCTTCAGACTGTCCCGAAGGAATGATTGTTGTATTTTAGTG
TAACAATAAACGGTTATCTTCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA
(446 bp)

- SilkBase 1999-2022 -