SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30111.Seq
JBrowseBomo_Chr6
chromosome_No.
Scaffold_id
Scaffold Length
chromo6
Bm_scaf49
2969584 bp
UniRef
UniRef50_Q4S6V3 (76%/92)
Cluster: T-complex protein 1, alpha subunit; n=3; Euteleostomi|Rep: T-complex protein 1, alpha subunit - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0000166 F nucleotide binding
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0006457 P protein folding
GO:0044267 P cellular protein metabolic process
Orthologue
Sequence
(Nucleotide)
AAAAGCGTGACGGCGATTTTAAAGTGAATTTTGTGTTAAAAATACAATAAAAAATGTCGA
CTATAGCTGCACCTTTGTCTGTAGCAGGGACAAGATCCTGCGGAGACCCAGTGAGAACAC
AAAATGTAATGGCAGCAGCGGCTATAGCAAACATAGTAAAGAGCTCCCTTGGGCCAGTTG
GTCTGGATAAGATGCTGGTTGACGATATTGGGGATGTTACAGTCACTAACGAAGGTGCCA
CAATATTAAAAATGTGGAAGTGGAGCATCCTGCTGCCAAAGTCTTAGTGGAACTAGCACA
GCTACAAGATGAAGAAGTTGGAGATGGTACCACATCTGTAGTCATCATTGCTGCTGAACT
ACTTAAGAATGCAGATGAACTAGTGAAGACCAAGATCCATCCAACAAGCATTATCTCAGG
ATACCGTCTCGCCTGTAAAGAAGCAGTCAAGTACATTCAGGATAACCTCACAGTAACAGT
AGAGTCACTTGGCAGGCCGTCTCTGATCACACAGCCAAAACAACCATGTCATCTAAACTA
ATTGGAGCTGATGCAGATTTCTTCTCGGAGATGGTTGTAGATGCTGCACAGGC
(593 bp)

- SilkBase 1999-2022 -