SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30108.Seq
JBrowseBomo_Chr19
chromosome_No.
Scaffold_id
Scaffold Length
chromo19
Bm_scaf36
4352778 bp
UniRef
UniRef50_Q8MSF5 (57%/84)
Cluster: GM16138p; n=12; Arthropoda|Rep: GM16138p - Drosophila melanogaster (Fruit fly)
Ontology
GO:0000003 P reproduction
GO:0002119 P nematode larval development
GO:0008150 P biological_process
GO:0009792 P embryo development ending in birth or egg hatching
Orthologue
Sequence
(Nucleotide)
AAACTGTCGCTTTGTGGCCTAGTTTTGAGCGTATGGGGCATCATTCAGTTGACGTTGATG
GGAGTCTTTTATTATATTCGAGCTGTCGCTCTGCTGGAGGATCTACCATTTGATGAGAAA
AATCCGCCTCATTCTATCGAAGACTTCGTCATTGAAGTGGAAAAAGGATATACCCTGAAT
GCACAAAATTGTTGGATTGCGGCATTGTTGTACTTGATTACACTGGTTGTATCTGGACAT
CAATTTTGGCTGAAAATCGTTCCTCAGTTAGTATGTAATATTGAAGGAGTTGTTATTTTT
GCTGTTAATTCCATTCCATTATAAAATTGTTTTTTCTTTTGCCAGAAACAGGTTGCTATA
TGTAATTATGTCTGTAATTAAGTTGTGTTTCTATCAATTGACAATATAGGTAAACATAGC
TAGCTACATATTACTCAAACTATTAAAACATCGTCATCGTCAGCCTGTATCTCTCCACTG
CTGGATGTAAACCTCTCCCATAGTCCGCACAATGCACGATCCTCTACCTTTCGCATCCAA
TTTTTTCCAGCATATTGCCACAAGTCATCAGCCCACTTATTTAAACAAAAC
(591 bp)

- SilkBase 1999-2022 -