SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30107.Seq
JBrowseBomo_Chr10
chromosome_No.
Scaffold_id
Scaffold Length
chromo10
Bm_scaf10
7317751 bp
UniRef
UniRef50_Q2U2J5 (36%/47)
Cluster: Predicted protein; n=1; Aspergillus oryzae|Rep: Predicted protein - Aspergillus oryzae
Ontology
GO:0003677 F DNA binding
GO:0006355 P regulation of transcription, DNA-templated
GO:0005515 F protein binding
Orthologue
Sequence
(Nucleotide)
CCATATTAAATGAAATCAATAAAATAAGACAAAATGTCGCCTTACTAGTGCGCGGAAAGT
AATCCAATAACANCTAAATATTGTGTGATTAAATCATCAAGAGGATCACAATGGAGANTT
CCTACGGTGTGGGAGTAGTGAACAGATACGCTCTTTTCTTGGACGATGAGACCGATCCTC
TTGATGCGTTAAAAGCGCGAGAGCAGGCGAAGGAGCTCAAAAAGAAGACCAAAGAAGCCG
AAAAAGAGAACAAAGCAAGCCTGAACCCAAGCCCGCTAAAGGCGTAACCGTTCCCACCCG
GAAGGGCATTAAGGAAACTCAAAATGTGAAGTCTNNGACATCAAAAGTGGAGAACAACAG
AAGGGTAAGGGACCTGCACGCCCGGTCGATCGTAATGTTGAGCGTCCGCCTCCGCGTCGT
CGTGAAGATCGGCCGCAGAACGGTACCGCAGAAAANNGGAAGGAGCTCNGCGGGCCACCG
AGACGCGAGTTTGGCGATCGTCGGCCTACTTCAACGAGCGCCGCAATTTTAACGACAACA
ACCAGGACGGTGCAGAGCGTTCGCGGTCCACCAAGACCACCGCGTGAGCCTTCGTGANGG
ACCGCGCGGGCCGCGTTTCTTTTGACAATAGAGGCNAACGTGATTTTCGACCGAAGATCC
GGCTCTGACAAAACCGGTGTGAAA
(684 bp)

- SilkBase 1999-2022 -