SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30104.Seq
JBrowseBomo_Chr5
chromosome_No.
Scaffold_id
Scaffold Length
chromo5
Bm_scaf54
2693215 bp
UniRef
UniRef50_UPI000051A21B (34%/150)
Cluster: PREDICTED: similar to CG3862-PA; n=2; Apocrita|Rep: PREDICTED: similar to CG3862-PA - Apis mellifera
Ontology
Orthologue
Sequence
(Nucleotide)
TATAACCTGAAATAAAAAAGTGCTTCGCGTTAAATACACTTGATTATTATAGATACAATT
TGTTTTTTGATTGTGGTATGCTTGGAAATTTAATTAATATGTATGCAGCTAAATTTTTAA
TACACCGGCGAAGTCCTGTTTTCTTGTTGAATCGAGTTTCCATTACGACTAAGAAGAAAG
TTCATGACCCAAGTGAAGAGGAGCTTTTACCAATATTCCAGTATCCAATAAGCAAAAGTA
CAGACAGACGAGTCATGTGTGGGGATTTGCTGAGACAGGTGCTCTGGGTATCCACCTCCC
ACGTGGCAAGAAAGGGAAAAAAAGTTACAAAAACAACTTCAAATTGGTTTGGCATCCAAT
GAGGTCTTCTTTTGCAGAGAGATTTGATATAACAAACATAGCCTGTGGCTACGGTTTCAC
AGTAGCCTCAATAAAAACTTCAGAGCAGCACAAAGTTTTCGGTACCGGTATCAATACAGA
TTCCCAAATTGGATACCATTCACCACGAGAAATCATCCTTTGGAACTTCTGGCTTAGCTA
TGCACCTATTTATATACCTTACAAGAGCTTGGGAGTGTGAGATTAAAGCAGTGGCAGCGG
GACGTGCTCACACAATAATCCTGACCGACAAAGAAGGTGTCTATACTTAGGTAACAATGC
CTATGGGTCAGTGC
(674 bp)

- SilkBase 1999-2022 -