SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30099.Seq
JBrowseBomo_Chr5
chromosome_No.
Scaffold_id
Scaffold Length
chromo5
Bm_scaf9
8107424 bp
UniRef
UniRef50_Q05639 (75%/141)
Cluster: Elongation factor 1-alpha 2; n=8397; root|Rep: Elongation factor 1-alpha 2 - Homo sapiens (Human)
Ontology
GO:0000166 F nucleotide binding
GO:0003746 F translation elongation factor activity
GO:0003924 F GTPase activity
GO:0005515 F protein binding
GO:0005525 F GTP binding
Orthologue
Sequence
(Nucleotide)
TTTGTAATCCGTGACTAACCAAAAATGGGCAAGGAAAAGACTCACATTAACATTGTCGTC
ATCGGACACGTCGACTCCGGCAAGTCCACCACCACTGGTCACTTGATCTACAAATGTGGT
GGTATTGACAAACGTACCATCGAGAAGTTCGAGAAGGAGGCCCAGGAAATGGGTAAAGGA
TCCTTCAAATATGCTTGGGTATTGGACAAACTAAAGGCTGAGCGTGAGNAGGTATCACAA
TCGATATTGCTCTCGGAAGTTCGAAACTAGCAAGTACTATGTTACCATCATTGATGCTCC
TGGACACAGAGATTTCATCAAGAACATGATCACAGGAACCTCTCAGGCTGATTGCGCTGT
GCTCATCGTAGCTGCCGGTACCGGTGAATTCGAAGCTGGTATCTCTAAGAACGGTCAAAC
CCGTGAGCATGCCTTGCTCGCTTTCACCCTCGGTGTCAAACAGCTCATCGTAGGAGTAAA
CAAAATGGATTCCACTGAACCACCATACGTGAGCCCAGATTTGAGGAAATCAAGAAGGAA
GTATCCTCATACATTCAAGAAGATTGGCTACAACCCAGCTGCTGTCGCTTTCGTGCCCAT
TTCTGGATGGCACGGAGACAACATGTTGGAGCTTCAACCAAAATGCCTTGGTTCAAGGGA
TGGGCAGGTGGAGCGTAAGGTAAGGCCAAGCTGACGGAAAATGCCTCATTGAAGCTCTCG
ATGCCATCCT
(730 bp)

- SilkBase 1999-2022 -