SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30090.Seq
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf1242
5249 bp
UniRef
UniRef50_A2I402 (66%/39)
Cluster: Ribosomal protein L29e-like protein; n=2; Neoptera|Rep: Ribosomal protein L29e-like protein - Maconellicoccus hirsutus (hibiscus mealybug)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0006412 P translation
GO:0003682 F chromatin binding
Orthologue
Sequence
(Nucleotide)
CTGATTCAAAGTGGTTCGTGTTTTTCTAAGCATGTTAAAAATTCGTTAAATATCANNAAA
ATCATTTAGGNGAATAAATATTTTAAAATAGAGTGAGCTATACGTTGTGTAGGTATTTAG
AGTAACGACTTTATTTTCCTTTACAGGNTTGAAAACTCANNAAAATGGCAAAGNNANAGA
ATCATACAAATCATAACCAGAACCGCAAAGCTCACAGAAATGGTATCAAAAAGCCAAGGA
AGACCAGGCACGAACCACCCTTGGCATGGATCCAAAATTTTTAAGGAATCAAAGGTTTTG
CAAGAAGGGNAACCTGAAGCCAGCCAAGCAACTCGCGAGGGCGGCTGAGAGAAAAGCTAC
CCGAGANGCAAAGGCCAAGAAATGAACATTAGTNGTAAGCAAATAANCGCATAAAAACTA
GAAAANANAAAGAAAAA
(437 bp)

- SilkBase 1999-2022 -