SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30080.Seq
JBrowseBomo_Chr10
chromosome_No.
Scaffold_id
Scaffold Length
chromo10
Bm_scaf10
7317751 bp
UniRef
UniRef50_UPI00015B50C6 (30%/84)
Cluster: PREDICTED: similar to CG4170-PA; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to CG4170-PA - Nasonia vitripennis
Ontology
Orthologue
Sequence
(Nucleotide)
TCGAATCGGTCCGCCATATTAAATGAAATCAATAAAATNAGACAAAATGTCGCCTTACTA
GNGCGCGGAAAGTAATCCAATAACATCTAAATATTGTGGGGTTAAATCATCAAGAGGATC
ACNATGGAGAATTCCTACGGGGTGGGNNTAGTGAACAGANACGCTCNNTNNTTGGACGAT
GAGACCGNTCCTCTTGATGCGTTAAAAGCGCGGNGGCAGGCGAAGGGGCTCANNAAGANG
GACCAAANAGGCCGGAAAGAGGACAAAGGCAAGCCTGAANCCAAGCCCGCTAAAGGCGTA
ACCGTTCCCACCCGGAAGGGCATTAAGGAAACTCAAAATGTGAAGTCTCAANNCATCAAA
AGTGGAGAACAACAGAAGGGTAAGGGACCTGCACGCCCGGNCGATCGNAATGTTGAGCGT
CCGCCTCCGCGTCGTCGTGAAGATCGGCCGCAGAACGGTACCGCAGAAAANTGGAAGGAG
CTCCGCGGNCNACCGAGACGCGAGTTTGCGATCGTCGGCCTAACTTCAACGAGCGCCGCA
ATTTTAACGACAACAACCAGGACGGTGCAGAGCGTTCGCGGTTCCACCAAGACCACCGCG
TGANCCTCGTNAGGCACCGCNCGGGGCCCGCGTTTCTTTTGNACAATAGAGGCAAACGTG
ANTTCGACCCGAAGATTCCGGCTTCTGACAAAAACCGGTNTGAAATTCAGTTCGACCAAG
AAGGGAAGGGCGCAAGNTTCCCCAACAAATTGGGGGGANAATCAAAGGACGATTTTCGAA
CNNGGTTGAACAAAAACCGGTTTCTTAANGGTTGAAANNACTTNAAGGNGAAGGGTCCCT
TAAAACCCGGCCG
(853 bp)

- SilkBase 1999-2022 -