SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30079.Seq
JBrowseBomo_Chr9
chromosome_No.
Scaffold_id
Scaffold Length
chromo9
Bm_scaf14
6760189 bp
UniRef
UniRef50_Q24333 (84%/19)
Cluster: Elastin like protein; n=1; Drosophila melanogaster|Rep: Elastin like protein - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005524 F ATP binding
GO:0006810 P transport
GO:0015662 F P-type ion transporter activity
GO:0016020 C membrane
Orthologue
Sequence
(Nucleotide)
GGTGGCGGCCGCTCTAGAAGGAGTGGATNGCCCGGGGTGCAGGAATTCGGCACGAGAAGA
CCTCTAAGAGAATCGTTATCAAAGACTGTNGTCAGATTGCCTAATTTAAATCATTAACTT
TAAAACAAACTGCAATATTTTAAGTTAAACACTAAGTCCTCCTGATAGATAAAAATACCT
TCCCAGTAANGNNTAATTTAANTGAAATATGGGTCATTCCAATTATTTAATAAAATATTG
CTATTGATGTAGCGACTGGTTATTGCATTTATTTCCATGCATTATTAGTATGTTCATTGT
TGCATTTTTGCTATTACNTTNNTATTTCTACTAGTTCGCTAGCTGTCTGTTTAGACCTNA
ATAATTCACATTATCGTAGACCTTTATTTATATCAACTTACTATGCTTCAATT
(413 bp)

- SilkBase 1999-2022 -