SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30044.Seq
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf1242
5249 bp
UniRef
UniRef50_Q24154 (46%/73)
Cluster: 60S ribosomal protein L29; n=12; Endopterygota|Rep: 60S ribosomal protein L29 - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003682 F chromatin binding
GO:0003735 F structural constituent of ribosome
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
Orthologue
Sequence
(Nucleotide)
CTGATTCAAAGTGGTTCGTGTTTTTCTAAGCATGTTAAAAATTCGTTAAATATCAANAAA
ATCATTTAGNNGAATAAATATTTTAAAATAGAGTGAGCTATACGTTGTGTAGGTATTTAC
AGTAACGACTTTATTTTCCTTTACAGGATTGAAAACTCATCAAAATGGCAAAGTCAAAGA
ATCATACAAATCATAACCAAAACCGCAAAGCTCACAGAAATGGTATCAAAAAGCCAAGGA
AGACCAGGCACGAACCACCCTTGGCATGGATCCAAAATTTTTAAGGAATCAAAGGTTTTG
CAAGAAGGGTAACCTGAAGCCAGCCAAGCAACTCGCGAGGGCGGCTGAGAGAAAAGCTAC
CCGAGAAGCAAAGGCCAAGAAATGAACATTAGTNGTAAGCAAATAANCGCATNAAAACTA
CGAANCACAAAGAAAAACTCGAG
(443 bp)

- SilkBase 1999-2022 -