SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30018.Seq
JBrowseBomo_Chr24
chromosome_No.
Scaffold_id
Scaffold Length
chromo24
Bm_scaf43
3469235 bp
UniRef
UniRef50_Q0LJP8 (25%/82)
Cluster: CRISPR-associated protein, TM1807; n=1; Herpetosiphon aurantiacus ATCC 23779|Rep: CRISPR-associated protein, TM1807 - Herpetosiphon aurantiacus ATCC 23779
Ontology
GO:0009058 P biosynthetic process
GO:0016740 F transferase activity
GO:0005506 F iron ion binding
GO:0006118 P obsolete electron transport
GO:0009055 F electron transfer activity
Orthologue
Sequence
(Nucleotide)
GAAANACTANTCGACAATTACTANANNNGGNANANTTAAGANATCGGANACNGAGACCAA
NGTANTNAANCAGGANNACANACCTGNTCTTCACTTAACATCACCTCCTACTTGCCTACA
GTGGACAACCGTCAGTCAATCAGTTTCGAACTTAAAAGGGAACCGAAGCAATTCAAATGC
GAGTACAAACGAANATGAGTCCCAATGCATANTATTAGGCACTACAAATGGTAAACTGTT
AATATACTCAATAATCAAGCGAAAATAATAAATGTTTGGGTGCCCGCCAAACATTTTAGC
GCTAAAGTGACCGCCCTGGATTGGAGTAGAAAATACGGTTTGTACAGCTGTACTAAGGAC
AGTAGAGTCTATGAGTGGAACATAGAAGATGGTTCAGTTAAACAAACCTATAATATTTCT
ATTGAAAATAATACGAAGCAGGGGAGCCATATAAACGCCATAAAAATTATACCACACAAT
CCAGCACCAGCNATCCCGGTACTTAGTACTGGCATCATATCAGCTCAGTCTTTGGAGGGC
TTCACAATAAAAGCTGTGACCATTGATTCAAGAGCTTAGGGATACCGTAACTTTCGCAGA
NCGCTTATTTCTGTCACTTGTCAGTTTCAATGAACACCNTATTTACCTTGTTGAAGGGGT
CAGAGAATGGAACGTCTTTCTATCCGTTCTGGGGACGTGANTGGTNCNCCTGATGGNAAG
GCACTCAAAAACAAACCAACGATTGANGCCGACNACCCAAACAAACGTTCNCCAAGAGNA
AAGGCNNCCGTNCGGGTGCCCGGTCCAAACCCCACGCCCCATGGT
(825 bp)

- SilkBase 1999-2022 -