SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamepsV30011.Seq
JBrowseBomo_Chr10
chromosome_No.
Scaffold_id
Scaffold Length
chromo10
Bm_scaf30
4522305 bp
UniRef
UniRef50_P27635 (78%/85)
Cluster: 60S ribosomal protein L10; n=53; Fungi/Metazoa group|Rep: 60S ribosomal protein L10 - Homo sapiens (Human)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005783 C endoplasmic reticulum
GO:0005840 C ribosome
GO:0005842 C cytosolic large ribosomal subunit
Orthologue
Sequence
(Nucleotide)
CGGCCAGCGAGATGCTACCGGTACTNCAAAAATAAACCGTATCCGAAATCGAGGTNCTNT
CGGGGTGTACCTGATCCCAAGATCCGTATCTTCGATTTGGGTAAGAANANAGCGANCGTT
GACGACTTTCCACTGTGCGTGCACTTGGTGTCCGACGAATATGAACAGCTGAGCTCAGAG
GCTTTGGAGGCAGGACGTATCTGCTGCAATAANTACCTCGTAAAGAACTGCGGNAANGAT
CAGTTCCATATCCGATGAGACTTCACCCTTTCCACGTTATCCGCATCAATAAAATGTTAT
CATGCGCTGGAGCTGATANGCTCCAGACTGGGATGCGTNGTGCGTTTGGCAAGCCTCAGG
GTACTGTAGCACGTGTTCGCATTGGACAGNNCATCATGTCCGTGCGGCTCTAGTGACAGG
TGGAAGGCACAGGTCATCGAGGNTCTGCGCCGTCGCCAAGTTTCAAGTTCCCCGGACGTG
CAAAAGATCTACGTATCAAAGAAGTCGGTTTCACAAAGTATGAACGTGATGAGTTTNNGA
AGCTGGCGTGAANAGGGCCGCCTCGCTAATGAACGGCTGCATTGTGGNATTACCNGCCCG
GANACATNGAACCTCTCGAACGCTTGGA
(628 bp)

- SilkBase 1999-2022 -