SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B18
JBrowseBomo_Chr7
chromosome_No.
Scaffold_id
Scaffold Length
chromo7
Bm_scaf15
6423983 bp
UniRef
UniRef50_Q5CXK3 (32%/64)
Cluster: Conserved protein with 6 transmembrane domain; n=4; Cryptosporidium|Rep: Conserved protein with 6 transmembrane domain - Cryptosporidium parvum Iowa II
Ontology
GO:0016021 C integral component of membrane
GO:0003674 F molecular_function
GO:0005575 C cellular_component
GO:0008150 P biological_process
GO:0008565 F obsolete protein transporter activity
Orthologue
Sequence
(Nucleotide)
GGATTTTGTTTAAGCTAGTTTGCGCCAAAACGAATATTACTTTGGTTATGTACCTACATA
TTACATACCAAATCCAAATACTCAATTAATATTTCGCTAGAAGTAATAGTGTTCTGTGAT
TAATATAATCTTTACTTAAGTACTCTTTTGCGATAATAAAATGAAAATGAAAGTCAAATG
GTATATCATAAGAAAGTAAACTTTTGCCCGGTAATAAGTAAAAATAAAAATTTAATACAA
CAAACGAAGATACGACTCATATTCAAATTATAACAATGTCGAAACGAAACAGCACAGGGG
CAGCCAATACTCTTTTCAACTATTTTACTAAAACACCGCCAACGAATAAAAAATTAAAAG
CGGACGCTACTGAAGATACCGATTGTAATGGTTCCCCGAAAAAGCAGTAAAAAAGGAATA
CATCTTGAAAACAAAAAACGCGAAAGGCAAATTACACCCTCACCGGAGCTTAAGAAGGCT
TCGAGTGATGAAGAAGAAGTTATTTCATTGCCAACTAAGAGAAAAAGAATAAGATTAAAT
CCAGTCGATTCTGATGATTCTGATGTTGAAAATAAAGCAGACAATAAAATTGGAACAACT
AAGAAGGAAGAAGATGAAGCANAGAGTGAGAAAAAGAAAGAAAGTATATTATAAAA
(656 bp)

- SilkBase 1999-2022 -