SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B17
JBrowseBomo_Chr7
chromosome_No.
Scaffold_id
Scaffold Length
chromo7
Bm_scaf132
607126 bp
UniRef
UniRef50_Q2F6C0 (91%/142)
Cluster: Cyclin-dependent kinase regulatory subunit; n=1; Bombyx mori|Rep: Cyclin-dependent kinase regulatory subunit - Bombyx mori (Silk moth)
Ontology
GO:0007049 P cell cycle
GO:0016301 F kinase activity
GO:0016538 F cyclin-dependent protein serine/threonine kinase regulator activity
GO:0051301 P cell division
GO:0005515 F protein binding
Orthologue
Sequence
(Nucleotide)
TCTTTCAATCGAAACGNTTGAAATTCAAACCGTATGGTTAAAAAATTACTCTAACCCTTA
GCGCTGTTGAAAATTATTAATTTTATTCGACGCAATTAAAACTACAGTAATGCCCGTGGA
CCAGATTCAATATTCGGAAAGATATACAGATGACGTCTACGAATACAGGCATGTCATCTT
ACCACCGGATATAGCCCGCATGGTGCCAAAATCCCATCTTATGACAGAGACAGAGTGGCG
AAACCTTGGTGTTCAGCAGAGTCCCGGCTGGCTCCACTTTATGGTGCACAATCCTGAACC
CCATGTTCTATTATTTAGAAGACCTAGAACTGATATACCGGCTCCCTTGAATGGCTTAGA
TACAAATACTAGTTCTGCTGTGAAGGTTTGACTGTTTTTGTTGCATAGGCATATTTTTAG
GTGTCATAGCTTAATATTATTTAAATTGCTTATTGAAACTATTATAGTTAAAACAAAAAA
AAAAAACTGTTCAATTTATTATAAATTAGCAGACATCAATTATTATTATATTACTTTATT
TTGTCTCAGTCTAAATTCAAATCGGGGGGTTTTAATACAATTATTCATGACTTTGGATAA
CACAAAGGCTTGTTTGTGGATAATTCTCT
(629 bp)

- SilkBase 1999-2022 -