SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B16
JBrowseBomo_Chr18
chromosome_No.
Scaffold_id
Scaffold Length
chromo18
Bm_scaf2
11281751 bp
UniRef
UniRef50_Q87IM2 (23%/97)
Cluster: Putative uncharacterized protein VPA0584; n=13; Gammaproteobacteria|Rep: Putative uncharacterized protein VPA0584 - Vibrio parahaemolyticus
Ontology
GO:0004221 F obsolete ubiquitin thiolesterase activity
GO:0006511 P ubiquitin-dependent protein catabolic process
Orthologue
Sequence
(Nucleotide)
TGGGTATTCGCAAACGTAACGCGCCGCCCACATTACCGGTGAGCCTTCTAGTCTCGTGTG
AAACAAACTTTAAAATTAAGACTTTTACCACTATGCTGAGAGAGAAATCCAGCTGTGAAA
ATCGCCATAGTACAGAGCAAGACAGGAGGCAATTGCCTTCTAATAGATTACCTCCTATCG
AGGAACTCACCCTTGGTCTGAAACAAAAGCTTCACCTGCAGGCTAGAGCTCGAGCTGCAC
CTTACTACATTAGAAAGCAGGAACCAGTTGATCTCGTGGAAAGGTTATTGGAGCAACGTG
CCCTTGTTGCTGAAGCTGTTCGAAGATTAAAAGAAAAGAAACAACCGTGTCATGAAATAT
CTGTAGATTCTTAATTTATAAACAAAACATTCTATCTGTGAAAGTGTGGAACATGTTGTG
AAATCGCTTGTGTGTATGAAACGTGTCGGATTACAATGGTGCTATATGCGGAGAGCGTGC
GAGAAAAGGATGGCTATCTGTGACGTGTCTTGCGCGACACGAGTCACGAGAACGAACTAA
AATGGCCGCACGTACTCTACAATCTACAATCATAATATTTATTCTTCGTTTATAGTGACC
TTAACTGATCATGATCAAAGTACTGAATGACGTAACTAGCCTTTAATGTTAAATTA
(656 bp)

- SilkBase 1999-2022 -