SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B15
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
chromo20
Bm_scaf96
1469819 bp
UniRef
UniRef50_P55828 (80%/66)
Cluster: 40S ribosomal protein S20; n=28; Eukaryota|Rep: 40S ribosomal protein S20 - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0005811 C lipid droplet
GO:0005840 C ribosome
Orthologue
Sequence
(Nucleotide)
TGTCTTTCTTTTTCAAAAGTTACTTGAAACGTGAGGTTTCTCCGGTTCAGCGCTGAACAA
TTTTTGATTTGAAAAGTTGTTTATCTCGGCCGGAATTCAACAAGCAACATGGCAGCCGCT
GTAGTGTCAGGCAAAGACATCGAGAAACCCCAGGCAGAGGTCTCCCCTATTCACCGCATC
AGGATCACTCTTACTTCTCGCAATGTGCGCTCACTCGAGAAGGTCTGTGCTGACCTAATC
AATGGAGCCAAGAAACAGAAGCTGCGTGTAAAGGGCCCAGTCCGCATGCCAACCAAGATC
CTGCGTATCACCACCCGTAAAACTCCTTGGTGGTGAAGGTTCAAAGACCTGGGATCGTTT
TCAGATGCGAATCCACAAGAGAGTGATCGACCTACACTCTCCCTCTGAAATTGTGAAACA
GATCACCTCAATTAACATCGAGCCCGGTGTAGAGGTTGAGGTGACCATCGCCGACGCGTA
GGCAGAGCCGCCAATAAAATATTTTTGAAAN
(511 bp)

- SilkBase 1999-2022 -