SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B14
JBrowseBomo_Chr13
chromosome_No.
Scaffold_id
Scaffold Length
chromo13
Bm_scaf1
16203812 bp
UniRef
UniRef50_Q4GXT1 (74%/159)
Cluster: Ribosomal protein S10e; n=3; Fungi/Metazoa group|Rep: Ribosomal protein S10e - Agriotes lineatus (Lined click beetle)
Ontology
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005737 C cytoplasm
GO:0005843 C cytosolic small ribosomal subunit
GO:0006412 P translation
Orthologue
Sequence
(Nucleotide)
TGTTCACGTACCGTGGCTTTTCTTGTGTTAAGTTAGCCTACAGGCGGCTTTCAAGATGTT
GATGCCCAAACAAAACCGTGTTGCTATTTATGAGTACCTCTTTAAAGAGGGAGTCATGGT
GGCCAAAAAAGACTATCATGCACCGAAGCATACTGAACTAGAGAAGATTCCTAACCTCCA
AGTTATCAAAGCTATGCAATCACTCAAGTCCAGAGGTTATGTCAAAGAACAGTTTGCCTG
GAGGCACTTTTACTGGTACCTAACCAATGAGGGTATTGAATACTTGAGAATATTCTTGCA
CCTTCCTCCTGAAATTGTGCCTGCAACACTTAAGCGCTCAGTACGTACAGAGACAGTACG
CCGTGGCCCTGTTGGTCGTCCTGATGCCCCAGCCCGCTCTGCTGAGGACAGATCTGCATA
CAGACGTACTCCTGCTGCCCCTGGTGTTGCACCTCATGATAAAAAGGCTGATGTTGGTCC
AGGCTCAGCTGATCTTGAATTTAAGGGAGGCTATGGACGTGGCAGGCCTGCTTCATAATT
TAAGCAATANAAAAACTT
(558 bp)

- SilkBase 1999-2022 -