SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B13
JBrowseBomo_Scaf395
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf1453
4011 bp
UniRef
UniRef50_Q4FH11 (59%/181)
Cluster: Cytochrome c oxidase subunit I; n=26; Bilateria|Rep: Cytochrome c oxidase subunit I - Samia cynthia ricini (Indian eri silkmoth)
Ontology
GO:0004129 F cytochrome-c oxidase activity
GO:0005506 F iron ion binding
GO:0005507 F copper ion binding
GO:0005739 C mitochondrion
GO:0005746 C mitochondrial respirasome
Orthologue
Sequence
(Nucleotide)
ATTTATTCTACAAATCATAAAGNTATTGGAACATTATATTTTATTTTTTGGTATTTGATC
AGGAATAATTGGAACATCTTTAAGNCTTTTAATTCGAGCTGAATTAGGAAATCCAGGATC
ATTAATTGGAGATGNTCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAAT
TTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTAT
ACTAGGAGCACCAGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTCCTACC
CCCCTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGATG
AACAGTTTACCCCCCACTTTCATCTAATATCGCACATAGAGGAAGATCCGTAGATCTTGC
TATTTTTTCACTACATTTAGCAGGTATTTCATCAATTATAGGAGCAATTAATTTTATTAC
AACAATAATTAATATACGATTAAATAATATATCATTTGATCAATTACCCTTATTTGTATG
AGCTGTAGGGATTACAGCATTTTTATTATTATTATCACTACCTGTTTTAGCTGGAGCTAT
TACAATATTATTAACAGATCGAAACTTAAATACATCATT
(639 bp)

- SilkBase 1999-2022 -