SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B12
JBrowseBomo_Chr22
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf18
5904300 bp
UniRef
UniRef50_P61927 (59%/82)
Cluster: 60S ribosomal protein L37; n=40; Euteleostomi|Rep: 60S ribosomal protein L37 - Homo sapiens (Human)
Ontology
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0005842 C cytosolic large ribosomal subunit
Orthologue
Sequence
(Nucleotide)
TTGCTTTTTCGGATTGTCAAGAGTGACAAGATGACGAAGCGGTACCTCAAGCTTCGGTAA
GCGCCGAAATAAGACCCATACGTTATGCAGAAGATGTGGTAGATCGTCATATCACATTCA
AAAATCAAAATGCGCCCAATGTGGATATCCTGCAGCAAAATTACGATCCTACCACTGGTC
AGTGAAGGCTAAGCGCAGGAAGACTACTGGAACTGGCCGCATGCGTCATTTGAAGATTGT
CAGGAGGCGCTTCCGTAATGGTTTTAAAGAAGGGAAACCAACGCCGCCCAAGAAGGCTGT
AGCTTCGTCATGAATCAATATGTGCTAAGTAAATAAAAATTAAAAAAACCAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG
(402 bp)

- SilkBase 1999-2022 -