SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B11
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf12
6701349 bp
UniRef
UniRef50_Q7RJC6 (95%/71)
Cluster: Ubiquitin; n=1; Plasmodium yoelii yoelii|Rep: Ubiquitin - Plasmodium yoelii yoelii
Ontology
GO:0006464 P cellular protein modification process
GO:0004252 F serine-type endopeptidase activity
GO:0006508 P proteolysis
GO:0016032 P viral process
GO:0019082 P viral protein processing
Orthologue
Sequence
(Nucleotide)
AAATGTTGGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTGAGCTCCGACACTGTGTCAAGATTTTATTTAAAATCCATCATACACA
GCAGTCGCGAGCGTTTCTTACAGGCTANAGGGGACTTATTTATTTGTCGTCGTCTTTGAA
NACCATCGTGCTGTGACACTTCCCGCAGTAGTGACGGTCCTCCATCACCGCCATGAACAC
TCCGGCGCCGCACTGCTCGCCCGTGCACTCGCGCCGCAAACGGTGGATCTTACCGTTCTC
GTCGACCTTGTAAAACCTGAGGACGGCTAGTTTGACCTTCTTCTTCTTGTGCTTGATCTT
CTTGGGTGTGGAGTAATTCTTCTTCTTGCGTTTCTTAGCGCCACCACGAAGCCTCAACAC
CAGGTGGAGGGTGGATTCCTTCTGGATATTGTAGTCCGANAGGGTACGTCCATCTTCCAG
CTGCTTTCCAGCAAANATCAACCTCTGTTGATTGGGAGGGATTCCCTCTTTGTCTTGAAT
TTTAGCTTTCACATTCTCGATGGTATCTGACGGCTCGACCTCAAGGGTGATGGTCTTGCC
CGTGAGGGTCTTTACGAAAATTTGCATCTTCACTCTCCNTTACGCTGTCACCAT
(654 bp)

- SilkBase 1999-2022 -