SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B08
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
chromo20
Bm_scaf37
4206046 bp
UniRef
UniRef50_Q8SYY6 (79%/64)
Cluster: RE27904p; n=8; Coelomata|Rep: RE27904p - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005783 C endoplasmic reticulum
GO:0005840 C ribosome
GO:0006464 P cellular protein modification process
GO:0006486 P protein glycosylation
GO:0006810 P transport
Orthologue
Sequence
(Nucleotide)
TGACTTTTATCTACGTGTCAAGCGAAATTGCGCGTTGTGGCTCTTCGAGTCCTTTTAATT
TATTATTAAACTGACAAATATACTTTATAACAAAACAAAATGGCCCCTAAGCAGAGAATG
CGTATCGCCAACGAGATCGCCAGTAAAAACATCACAATGAGGGGGAATGTACCCAAAACT
ACCAAGGAAAAAGAAGACCAATATCCTGTGGCACCCTGGCTCCTTGCTCTCTTCATCTTC
GTAGTGTGTGGCTCTGCTGTGTTCCAGATAATCCAATCAATAAGACTAGCTTAAATCACG
AAGACAACTGGAGAACTGCTATCGAAAACACAATAAAATAACAACACTATCCATCTAAAG
TTAGGCACAATTTACACCAGCATCTCTTCGTCGACATGAGAGAGAGTGTTTTCGGAGGCG
GCCATTAGTACCTTTAACTGTGCAATCGTGGCTTGATGTCTCTTTCACACTTACAGGGTT
ANAACGGGACGCCGATACATAAGGTTATTA
(510 bp)

- SilkBase 1999-2022 -