SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B07
JBrowseBomo_Scaf119
chromosome_No.
Scaffold_id
Scaffold Length
chromo16
Bm_scaf4
9119588 bp
UniRef
UniRef50_A6QZG7 (30%/83)
Cluster: Predicted protein; n=1; Ajellomyces capsulatus NAm1|Rep: Predicted protein - Ajellomyces capsulatus NAm1
Ontology
GO:0003676 F nucleic acid binding
GO:0005622 C intracellular anatomical structure
GO:0008270 F zinc ion binding
Orthologue
Sequence
(Nucleotide)
TTTGAATATCGATTGAACACTTGACCATTAATGTTATTTAAATACTTGTTTGTGAGTGAT
AATGTCAATTCTTACTTCCTGTCATAATATTAAAGGTTTTGGTTATGTTCCGCGCAGACT
AAGAACTGCCGAGATTGTTTTTTCTACCTATGCTGATAGTGATAGCCTTGAGAGGCTATG
TCAGTTTCTTGTGGACGTGTTGATTTACGGGGCTCAAACCAGAAGACTCACTGAGAAGGT
CCGGCGAGAAACTCAGTGGGCTGTGTTAATTTACTCGTCGAGCCCTTCGTCGCAAGCGAA
GGGTTGGCGGAGGGCGGTGACCGGTGCTTGTGGTACTTAAAAGCACCGTTAAGGGATCGG
GAGGATCCGTAATGACGTTTGGGGCTCTGAGATATGAATACTGCCGCTGTATCGATTTAC
TTTACATAAGAAATGTGTACCTACCTATTGTTCAGAGCCGAGGTACGTATCAGCTGTAAC
AATGATAGCGGTAAGTGTGTGCCACCTCGCTTGCTTGTGCTATTGATAGACAGTATCTTG
TTTATTCCCGAAAATATTTACCTACTTGGGAACATTTGTTTTCGTCGTTAGGATTCTTTT
TAGTTTACATTATATACAGTCATATACCAGTACTTTGTTGTGGTGAGAAAAT
(652 bp)

- SilkBase 1999-2022 -