SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_B02
JBrowseBomo_Chr25
chromosome_No.
Scaffold_id
Scaffold Length
chromo25
Bm_scaf65
2150616 bp
UniRef
UniRef50_Q9VH69 (94%/36)
Cluster: 40S ribosomal protein S29; n=31; Eukaryota|Rep: 40S ribosomal protein S29 - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0006412 P translation
GO:0008270 F zinc ion binding
Orthologue
Sequence
(Nucleotide)
GCTTTCGTTCAAGTTCGCCATCTTGNAGTGTTGTCTCTAATTTTGTTGCTCGTTAGCGAA
GCAACAATTTAATTTCTTAAAATGGGCCACGCAAATATTTGGTATTCTCACCCTCGCAGA
TACGGACAAGGATCTCGGNTCATGCCGATCCTGCTCCAACAGGCATGGCTTAATCCGCAA
GTACGGTTTGAACATATGCAGACAGTGCTTCAGAGAGTATGCTCATGACATAGGATTCAA
GAAGCTGGACTAAATGGAGTAGGAATAATAAATTTTACTTTTAAATAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANA
(347 bp)

- SilkBase 1999-2022 -