SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A24
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf33
4426693 bp
UniRef
UniRef50_Q71DI3 (89%/59)
Cluster: Histone H3.2; n=3155; Eukaryota|Rep: Histone H3.2 - Homo sapiens (Human)
Ontology
GO:0000786 C nucleosome
GO:0003677 F DNA binding
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0005694 C chromosome
Orthologue
Sequence
(Nucleotide)
TGTTTTTGATTCTCTCCGACGCCATTTTGAGCATATGATCGTTGTTGTGAAATTGGTCAA
TAAATTCTAAAATAATAGAAAATTAGTAGCTTAACTTGTGAAAAACATTAAAAAAGTAAA
CAATGGCTCGTACTAAACAAACTGCCCGTAAATCTACTGGAGGTAAAGCTCCGCGTAAAC
AACTTGCTACAAAAGCGGCGCGAAAATCAGCGCCGAGCACTGGTGGAGTCAAGAAGCCAC
ATCGTTATCGCCCTGGNTACAGTGGCCCTTCGTGAAATTCGTCGTTATCAGAAGTCTACT
GAGTTGCTTATCCGTAAGCTGCCTTTCCAGCGTCTTGTGAGAGAAATCGCTCAGGATTTC
AAAACTGATTTGCNTTTCCAGTCTGCCGCCATCGGAGCTCTCCAGGAGGCAAGCGAGGCT
TATCTCGNTTGGCTTGTTCGAAGACACCAACTTGTGTGCTATTCACGCCAAACGTGTGAC
CATCATGCCGAAGGATATTCAACTTGCTCGACGAATCCGTGGTGAACGTGCTTAAATTAG
TTTAATTGTAATTTTGATTAGATGTAATTCTGTAACTTTTTTATGTCTCACTTATATTAA
ATTAACCTTAAATATTATAATATCCATTACATCATAAGGAGGCAGAACTGATT
(653 bp)

- SilkBase 1999-2022 -