SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A23
JBrowseBomo_Chr18
chromosome_No.
Scaffold_id
Scaffold Length
chromo18
Bm_scaf2
11281751 bp
UniRef
UniRef50_P39019 (65%/87)
Cluster: 40S ribosomal protein S19; n=127; Eukaryota|Rep: 40S ribosomal protein S19 - Homo sapiens (Human)
Ontology
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0005730 C nucleolus
Orthologue
Sequence
(Nucleotide)
GCTTTTTTTCTTCCGGTTGCCAACACAAGGCAAGATGCGTTCCGTCACAGTAAAGGATGT
TGAACAAGACAAGATTGTTAAAACTGTCGCTGCTCACTTAAAAAAAACGGGCAAAGTCAA
GGTACCTGAGCACATGGATCTTGTAAAGACAGCTCGCTTCAAAGAGCTGGCTCCGTATGA
CCCTGNATTGGTTCTATGTGCGTTGTGCTGCCATCCTTCGTCATATTTACATTCGCTCAC
CTGTTGGAGTAAAGACTGTCACCAAGATCTTTGGTGGGCGCAAACGTAATGGAGTTACAC
CTTCACATTTCTGCAGGTCATCAGGCAGTATTGCACGCAAGGCTTTGCAATCGTTGGAGG
CATTGAAGCTTGTTGAGAAAGTTCAGGACGGTGGTCGCATTCTCACCACACAAGGTAGAC
GAGACCTTGACAGAATCGCTGCCCAGGTTCGTCTAAAGGCCAAGCAGCAGGCTAAGCAAC
AANTCTCATTGTACTTTAATTTTATGCTAATAAAAATATAAAATTTT
(527 bp)

- SilkBase 1999-2022 -