SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A21
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf22
5301712 bp
UniRef
UniRef50_Q7Q5J0 (27%/121)
Cluster: ENSANGP00000021022; n=4; Culicidae|Rep: ENSANGP00000021022 - Anopheles gambiae str. PEST
Ontology
Orthologue
Sequence
(Nucleotide)
TGAGTTATTTGCAGCAACCAGACTGACTGCGCACGCGACTTGTTTTTGAAATACATTCGC
GAACGGTCGTAAACTGAATTTAATTCAAAAATATTAGTGCACATCTATTCCGTCCGAGAA
GTGAATTATTTGCAGTAGAGGCAGAATGAAGTATATAGCATTATTAACGATATTAATTAT
ATCGCAGGTGTATTCGGCGCCTCAGTTTATAACCTTCAAGGATGGTAAGATAGGCGTGAA
CTTCGGCGGTTACCACGCTGGAGTCGGGCTCGGAGGTTTATTAGGTGGTGGTGCAGGTAC
TGGAGGGTTATTTGCTGAAGCAGGAACTCCTCATGGCCAATCAGCAAGGGCAGGATTAGG
TGGAGCAGTCGATGGCAATGGCCGAGCCGGAGGTGGACTTTATGCTGGAGCTACGGCAGG
TGGCAACGTCAAAGCAGAAGCTGGTCTTGCAGGAAGAGTAGCTTCAGAAGACGTAGCAGG
CAATGGATTTGCAACTGCTCAAGCAGGAGGTCATAATGCTGTTTCTGGCTTGGTAAGAAG
CAAAGAGGAACGACGCAAACGCAAAGAATTGAAAAAACTGTTAAAGAATCANAAGCACCT
TTAATTGGTGAAGGACGTCATTATATTTACCTATTATTATTAATTGATGTG
(651 bp)

- SilkBase 1999-2022 -