SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A19
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf33
4426693 bp
UniRef
UniRef50_UPI0000DB7531 (57%/103)
Cluster: PREDICTED: similar to CG15387-PA; n=1; Apis mellifera|Rep: PREDICTED: similar to CG15387-PA - Apis mellifera
Ontology
Orthologue
Sequence
(Nucleotide)
GGATTTGATTTGAAGTAATCCAGCAAAATTAACAAGAAAAAGCAATTCCTGAATTTCTTG
GCCCTTTTCAAAGAAAGCTGTTTTAATTAGATATTAGATCATGCGGCCATGATTAGAAAC
TAAAACATGTCGTCCCCTCAAAGCGTATCAGTCGATCAAATGCGACAAATACTAAATGAA
ATTATAGACGCCCTGGAATCGCCTGATTATGCTTCCAAACTCGATGAAGCTAAAGAAGCT
GCTGGTAATGAGATGTTGAAAATGATGCAAATAGTCTTCCCCATGGTTGTGCAAATAGAA
ATGGAGACAATAAAGCACCATGGCTTCAATAATTCACGTGAAGGCATAGTTCAATTCACT
CAGCTTATTCGTGACCTGGAGAGCATTGATGGTGAGGTTGCCCGTCTTCATACTCAAATC
CGAAGCCACTACCTGCCCCCTGTGTCCATCAGTTCTTCTGTTGACACATCTTTGTAAAAC
AGTATTAAAGGTAAGACCTGGAACTCTTCTACTGTTAATGGAGTGTTGAGATTCTCAAAA
CTTGCATTTATTTTACAAACCAATATTTATACTATTTAATTATGTTTAGTAACAAATAAA
T
(601 bp)

- SilkBase 1999-2022 -