SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A17
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf3
9954263 bp
UniRef
UniRef50_Q9V3G1 (80%/185)
Cluster: 60S ribosomal protein L8; n=71; Eukaryota|Rep: 60S ribosomal protein L8 - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005737 C cytoplasm
GO:0005840 C ribosome
Orthologue
Sequence
(Nucleotide)
GCTTTTCAATTTTGACCGTCTGTGAGNTTGACGGGTCGTAATCATGGGTCGTGTAATACG
TGCTCAGCGTAAGGGTGCCGGTTCAGTTTTCGTTTCTCACACGAAGAAGAGGAAAGGCGC
TCCTAAACTTCGCTCTTTAGNATTACGCTGAACGTCATGGATACATCAAGGGAGTTGTTA
AGGATATAATCCATGACCCTGGTAGAGGTGCACCTTTGGCTGTTGTACACTTCCGCGATC
CATACAAGTTCAAGACAAGGAAGGAGCTCTTCATTGCTCCCGAAGGGCTCTACACAGGCC
AATTTGTTTATTGTGGAAAGAAAGCAACTCTTGAAGTTGGAAATGTGATGCCTGTTGGAG
CTATGCCTGAGGGTACCATTGTGTGCAATCTTGAAGAGAAAATGGGTGATAGAGGTCGTC
TGGCACGTGCCTCTGGAAACTTCGCCACTGTGATTGGACACAATCCTGATGCTAAGCGTA
CAAGAGTAAAGCTACCGTCTGGAGCCAAGAAGGTTCTGCCATCAAGCAACAGAGGCATGG
TCGGTATTGTTGCTGGAGGTGGACGTATTGACAAACCTATTTTGAAAGCTGGAAGGGCAT
ACCACAAGTACAAGGTCAAACGTAACTGCTGGCCATATGTACGTGGTGTTGCCATG
(656 bp)

- SilkBase 1999-2022 -