SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A16
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf83
1589841 bp
UniRef
UniRef50_Q1WWB7 (34%/161)
Cluster: IP10750p; n=4; Diptera|Rep: IP10750p - Drosophila melanogaster (Fruit fly)
Ontology
GO:0004252 F serine-type endopeptidase activity
GO:0004287 F obsolete prolyl oligopeptidase activity
GO:0006508 P proteolysis
GO:0008236 F serine-type peptidase activity
Orthologue
Sequence
(Nucleotide)
GNGTTTTGTTGTTGTGCGTAGTTGTGGTTTAGTTTCTAATGGCTTAATTAATTTTGTTAA
TCGTTTTAATTTCTAATTCCGACACAAGTTTTGGTTTGAGCTTGTCCAAAAATGGCACTG
CTTCCTCCGGNATCCTGTTTACACTATCCGAAATGTCGATAATGTGCCAGTTTATTCACT
GGCTTTCAGTTTTTTACCCGGGGGCTTAGAGAGGTTACTAGCCGGTTCGAAAAACGGTTA
TGTTTACGCATACAACCTCCAGACAAATAGAGTTCAGCAGAAGATACAAGTTGGTCAAGC
TCCTATTCTTCATCTTATACACACTGACAGCCACCTTATAACCCAAGAGAAAGGTGGAAA
GCTTAAGGTTTTCGAATTAACGAATAGTGGTTATGAAGAAGATGCCGTAATTGAAGTAGA
TTATCCTGGTTTTTGTAGATTCGAAGCCAACACAAAACTCGCATCACTCTATGTACCTGA
GAAGGATTACAAAATAAACATTTACAATTTTAATGGAGAAAAACTGGGTTCCTTAGAATA
TGATGATGCATCAGTGAAACTTGGCGATGTAATGTGTCTAAAATTCATTGAGTTCCCATG
CGATAGACCTTGNTCTACTAGCTGGTTACGAAGCAGGTTGGCTCTTGTTATGG
(653 bp)

- SilkBase 1999-2022 -