SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A15
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf59
2341090 bp
UniRef
UniRef50_P62857 (78%/51)
Cluster: 40S ribosomal protein S28; n=137; Eukaryota|Rep: 40S ribosomal protein S28 - Homo sapiens (Human)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0005843 C cytosolic small ribosomal subunit
Orthologue
Sequence
(Nucleotide)
TGCTTTTCGAAACACGCCAGCTTTGGTTGCACGTGTGCTTATTGCATTAAGCTCGATATT
ACAAGCCAAAATGGATAAACCCAACGTTCTTGCTCGTGTCGTGAAAGTGCTTGGCCGTAC
TGGTTCTCAGGGCCAGTGTACTCAAGTGAAGGTCGAGTTCATTGGGGAGACCAGCCGTCA
GATCATCAGAAACGTGAAAGGACCCGTCCGTGACGGAGACATCCTCACTCTTCTTGAATC
TGAACGTGAAGCTAGGAGGCTGCGATAGATTATTGCAGCATTACTGCATTAGGTTAAGGC
ATTCACATGTACCATCTACATAAATTTATGTGTTAAACTTACAAAACCGTCAAAGATGAC
CATCTTATTGTATTCAGCTCGGAATAAATACATAACATAAAANAAAAAA
(409 bp)

- SilkBase 1999-2022 -