SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A09
JBrowseBomo_Chr3
chromosome_No.
Scaffold_id
Scaffold Length
chromo3
Bm_scaf102
1187377 bp
UniRef
UniRef50_O18640 (89%/107)
Cluster: Guanine nucleotide-binding protein subunit beta-like protein; n=18; Eukaryota|Rep: Guanine nucleotide-binding protein subunit beta-like protein - Drosophila melanogaster (Fruit fly)
Ontology
Orthologue
Sequence
(Nucleotide)
CGCTTCAGGGNAGTCGTCGCTCTTCAAACCATTTTCAAAAATGTCTGAAACATTAAAACT
CCGAGGAACTCTTAGAGGCCACAATGGCTGGGTTACTCAAATTGCAACTAATCCGAAATA
CCCGGACATGATTTTATCTTCGTCTCGAGACAAAACTCTCATCGTGTGGAAGTTGACCAG
AGACGAAAACAACTACGGTATACCTCAAAAGCGTTTATACGGTCATTCGCACTTCATTTC
TGATGTTGTGCTGTCTAGTGACGGTAATTACGCCCTTTCCGGTTCTTGGGACAAGACTTT
GCGTTTGTGGGATCTCGCTGCAGGCAAGACTACCAGACGATTCGAGGACCATACTAAGGT
GTGACAGAACTCTTAATTTTGTTAGGGTGTAAATGCTGATTATGCACTGAAGATAATCCT
AAGTGCCTATGCGAGGCAGAAGACCAGTGTTTTGTGCCTTTGCGAGGCAGAAGATTGTGT
TTGTGTTGTAAAAGTCTGAGGTAAGATGGTAGTATAATTATAGTATTGTAAATATACCGA
CCATCATACAACAGTCTGTTAACAATTTAAAGTGTAGTTGAATTGATAAGTTTTTTGTTT
ATATCACAGGATGTACTCTCGNGTAGC
(627 bp)

- SilkBase 1999-2022 -