SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamefprWP01_F_A04
JBrowseBomo_Chr21
chromosome_No.
Scaffold_id
Scaffold Length
chromo21
Bm_scaf86
1549195 bp
UniRef
UniRef50_P48809 (84%/117)
Cluster: Heterogeneous nuclear ribonucleoprotein 27C; n=11; Endopterygota|Rep: Heterogeneous nuclear ribonucleoprotein 27C - Drosophila melanogaster (Fruit fly)
Ontology
GO:0000166 F nucleotide binding
GO:0003676 F nucleic acid binding
GO:0003697 F single-stranded DNA binding
GO:0003723 F RNA binding
GO:0003730 F mRNA 3'-UTR binding
Orthologue
Sequence
(Nucleotide)
TGGTTGTCTTTACCGGTGCCAACCTTTATTTTATAATTAGTAGTAAGGTATGCGTATGAA
TCCAGACATGGACGATGATGAGAAGGGAAAACTATTTGTTGGAGGACTATCATGGGAAAC
ATCCCAAGAGAACTTGCAACGCTATTTCTCACGTTATGGCGAAGTGATCGACTGTGTCGT
CATGAAGAATAGCGAGTCAGGACGTTCGAGGGGCTTTGGTTTCGTGACATTTGCTGATCC
TTCACTGGTCAACCTCGTGCTACAGAATGGACCTCATCAACTTGATGGCAGGACCATCGA
CCCTAAGCCGTGCAATCCTCGCACTCTTCAAAAACCGAAACGTGGCGGTGGATACCCTAA
GGTGTTCCTTGGCGGGCTGCCATCGAACGTTACCGAAACCGATCTCAGGGNTATTTTTCG
GACGCTATGGGAAGGTCATGGAGGTGGTCATTATGTATGATCAANAGAAGAAAAAGTCTA
NGGGTTTNGGATTCTTGTCTTTCGAGGATGAANTNTCTNGTTGACAGAGTGACCCAAGAA
CACTTCATTAACCTCCACGGGAAGCAGGTTGANATAAAGCGCGCTGA
(587 bp)

- SilkBase 1999-2022 -