SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
Namebmov2p23
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_A3XPA0 (50%/71)
Cluster: Molybdenum cofactor biosynthesis protein A; n=4; Bacteroidetes|Rep: Molybdenum cofactor biosynthesis protein A - Leeuwenhoekiella blandensis MED217
Ontology
GO:0003824 F catalytic activity
GO:0005506 F iron ion binding
GO:0006777 P Mo-molybdopterin cofactor biosynthetic process
GO:0008152 P metabolic process
GO:0019008 C molybdopterin synthase complex
Orthologue
Sequence
(Nucleotide)
attttttttttttgtttacgtacgtgcaataagccgaccgcaataaaatgaaaattcgga
ctaataatttttcatctttatatcgcatttttgaatgcgatctaanaacaataaaatcgt
gtttccgggctattactgtacccgatagattgtacagtgatgacagccgtgtggaggcgg
cggcctcattaagcgacctacatggtcgtcgacacaactacctgcgaatatctctcactg
agcgatgcaacctgcgatgcaagtactgcatgccggcggaaggcgtgcccctgtccagtc
gcagctcgctgctgtcagtggaagagctgcgggtgatantgggcgcgctggcggccgccg
gcgtggacaagctgcggntcaccggnggggagccgacgc
(399 bp)

- SilkBase 1999-2022 -