| Name | bmnc5j18 |
| JBrowse | Bomo_Chr22 |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_P41658 (100%/34) |
| Cluster: Late expression factor 5; n=13; Nucleopolyhedrovirus|Rep: Late expression factor 5 - Autographa californica nuclear polyhedrosis virus (AcMNPV) |
|
| Ontology |
| GO:0006350 |
P |
transcription, DNA-templated |
| GO:0006355 |
P |
regulation of transcription, DNA-templated |
| GO:0030528 |
F |
obsolete transcription regulator activity |
| GO:0045449 |
P |
regulation of transcription, DNA-templated |
|
| Orthologue |
|
Sequence (Nucleotide) | actgttacaaaatcgtgtctgcaagattttaaactaagcccgctaagctcaaatagttta
tttttattactgttttgtaaataaataactttatcattcaatatcaaaaaaaaaa
(115 bp) |