| Name | bmnc4o08 |
| JBrowse | Bomo_Scaf167 |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_A3GEZ7 (44%/29) |
| Cluster: Universal stress protein (USP) family protein possible involvement in nucleo-mitochondrial control of maltose, galactose and raffinose utilization; n=6; Saccharomycetales|Rep: Universal stress protein (USP) family protein possible involvement in nucleo-mitochondrial control of maltose, galactose and raffinose utilization - Pichia stipitis (Yeast) |
|
| Ontology |
| GO:0006950 |
P |
response to stress |
|
| Orthologue |
|
Sequence (Nucleotide) | gagaattttaaagtgctccttaagtgttttaagttacaaatttatatttcggtagaattt
ttgatttatcccgaaccccagcacgtaacgatacattttttgggcaaaaaaaactttcca
tgtacgtcgctctagaggtggtgttttaaaaaaaaaa
(157 bp) |