| Name | bmnc22a18 |
| JBrowse | Bomo_Chr23 |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_P41477 (100%/30) |
| Cluster: Late expression factor 4; n=13; Nucleopolyhedrovirus|Rep: Late expression factor 4 - Autographa californica nuclear polyhedrosis virus (AcMNPV) |
|
| Ontology |
| GO:0006350 |
P |
transcription, DNA-templated |
| GO:0006355 |
P |
regulation of transcription, DNA-templated |
| GO:0030528 |
F |
obsolete transcription regulator activity |
| GO:0045449 |
P |
regulation of transcription, DNA-templated |
|
| Orthologue |
|
Sequence (Nucleotide) | tcgaaggcagtttgatttctttgctctctctccacaccaacggcaccaacgcgttggtat
ctttaggccaataaacaaattttttgtgtttggaaaaaaaaaa
(103 bp) |