| Name | S06A01NCLL0024_G20 |
| JBrowse | |
chromosome_No. Scaffold_id Scaffold Length | unknown
bp |
| UniRef |
|
UniRef50_UPI00015B51A8 (48%/60) |
| Cluster: PREDICTED: similar to thyroid hormone receptor interactor 12; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to thyroid hormone receptor interactor 12 - Nasonia vitripennis |
|
| Ontology |
| GO:0004842 |
F |
ubiquitin-protein transferase activity |
| GO:0005488 |
F |
binding |
| GO:0005622 |
C |
intracellular anatomical structure |
| GO:0006464 |
P |
cellular protein modification process |
| GO:0006512 |
P |
obsolete ubiquitin cycle |
|
| Orthologue |
|
Sequence (Nucleotide) | tttcggcacgaggaaaggctgttatggattcgcgtatggttgatattccactatcggtca
ctatgtaccgttgggtggtgaacgaagacaggtggctgaatttaagcgatgtgcgacacg
tggcaccggagctgtggcgttctctatgtcggctgcgtcgtgtggctgatcgtgcacaaa
tgatcgctgccgattctaggca
(202 bp) |